The role of sRNA molecules in rye - leaf rust interaction. Secale cereale cultivar:D33, D39, L318

Leaf Rust (LR) caused by Puccinia recondita f. sp. secalis is one of the most damaging diseases of rye. Despite its importance, a knowledge about the genetic background of rye response to this disease is still limited and the involvement of small RNAs and microRNAs in the plant-pathogen interaction was not known at all until we started our research.In this paper, dynamics of different sRNAs in response to LR was studied in three rye lines (D33, D39 and L318) epitomized different level of immune response to LR and two Prs isolates inducing two types of host reactions to the fungal pathogen: compatible (CP) and incompatible (ICP). Two miRNA detection algorithms were applied, ShortStack and miRDeep2 , detecting true miRNAs, according to the strict, biosynthesis of miRNA rules. We performed differential expression analysis of all small and miRNAs and detected potential mRNA targets. In the next step, we compared targets is compatible (CP) and incompatible (ICP) host pathogen interactions. Subsequently we manually scanned different isoforms of miRNA transcripts originating from the same miRNA gene (isomiRs) and examined the differences in their potential targets. We found that isomiRs could broaden range of targets important for plant defense against pathogens, for example: UGUGUUCUCAGGUCGCCCCCG targets 11 different endoglucanase genes and two superoxide dismutase genes. They code for proteins well known for their role in plant defense. The shorter sequence, UCAGGUCGCCCCCGCUGGAG targets 16 transcription factors including MADS box. Finally, we surveyed miRNA-like RNAs (milRNAs) from rust and their predicted targets in rye. Because of our experimental design, we compared their total assortment in compatible and incompatible reactions and their expression dynamics in the two time points. Compatible reaction stimulates more diverse set of milRNAs, with much more targets, many of whom represent transcripts of genes involved in biotic stress response.