Expression of genome-edited bantam in vivo ("m2" mutant)

Small RNA-Seq of 1st instar D. melanogaster larvae expressing either: wt bantam only ("TM6" library), or heterozygous (wt and mutant bantam alleles) ("m2(proximal)", "m2(distal)" and "m4" libraries). A control library ("M2_spike") was prepared from heterozygotes expressing both wt and "m2" mutant alleles, and spiked-in with equimolar amounts of synthetic oligos UGAGAUCAUUCGCAAAGCUGAUU and UCAAAAUAUUCGCAAAGCUGAUU (to evaluate potential biases in the detection of wt and mutant miRNAs).