sRNA_seq_clean_thrips_leafdiscs_timeseries
收藏资源简介:
2023-03 Timeseries experiment with clean thrips on leafdiscs of tomato MoneyMaker plants. srna and mrna were extracted with the kit 'NucleoSpin miRNA, Mini kit for miRNA and RNA purification'.<br> contains (see metadata file for more info): - 20x leafdiscs samples as controls (5 biological replicates/wells for 4 timepoints: 3h, 6h, 9h, 12h) - 20x leafdiscs samples with thrips (5 biological replicates/wells for 4 timepoints: 3h, 6h, 9h, 12h) - 5x whole thrips feeding on leafdiscs for 12h (same experiment, as leafdiscs) - 2x the heads of thrips feeding on tomato for 24h+, i.e. salivary glands enriched samples - 2x the eggs of thrips Barcoded Small RNA-Seq libraries were generated from the small RNA according to the manufacturers’ protocols using the Small RNA-Seq Library Prep Kit (Lexogen). The size distribution of the libraries with indexed adapters was assessed using a 2200 TapeStation System with Agilent D1000 ScreenTapes (Agilent Technologies). The libraries were quantified on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific) using the NEBNext Library Quant Kit for Illumina (New England BioLabs) according to the instructions of the manufacturer. The libraries were clustered and sequenced (75 bp) on a NextSeq 550 Sequencing System (Illumina) using a NextSeq 500/550 High Output Kit v2.5 (75 Cycles) (Illumina). Adapter: TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC



