rCRUX Generated Taberlet c/h trnl Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.

Primer Name:  Taberlet c/h trnl
Gene:   trnl
Length of Target:    150
get_seeds_local() minimum length:    105
get_seeds_local() maximum length:    150
blast_seeds() minimum length:    85
blast_seeds() maximum length:    128
max_to_blast:  100
Forward Sequence (5'-3'):   CGAAATCGGTAGACGCTACG
Reverse Sequence (5'-3'):    CCATTGAGTCTCTGCACCTATC
Reference:   Taberlet, P., Gielly, L., Pautou, G., & Bouvet, J. (1991). Universal primers for amplification of three non-coding regions of. Plant molecular biology, 17, 1105-1109. & Taberlet, Pierre, Eric Coissac, François Pompanon, Ludovic Gielly, Christian Miquel, Alice Valentini, Thierry Vermat, Gerard Corthier, Christian Brochmann, and Eske Willerslev. "Power and limitations of the chloroplast trn L (UAA) intron for plant DNA barcoding." Nucleic acids research 35, no. 3 (2007): e14-e14.

We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.