Table 2 in Widespread polytypic species or complexes of local species? Revising bumblebees of the subgenus Melanobombus world-wide (Hymenoptera, Apidae, Bombus)

Table 2. Primer sequences for the sequenced regions of the four genes.
GenePrimer namePrimer sequenceReferenceCOILepF5’- ATTCAACCAATCATAAAGATATTGG -3’Hebert et al. 2004LepR5’- TAAACTTCTGGATGTCCAAAAAATCA -3’Hebert et al. 200416S16SWb5’- CACCTGTTTATCACCTGTTTATCAAAAACAT -3’Dowton & Austin 1994874–16SlR5’- TATAGATAGAAACCAAYCTG -3’Cameron et al. 1992OpsinLWRhF5’- AATTGCTATTAYGARACNTGGGT -3’Mardulyn & Cameron 1999LWRhR5’- ATATGGAGTCCANGCCATRAACCA -3’Mardulyn & Cameron 1999PEPCKFHv45’- TGTATRATAATTCGCAAYTTCAC -3’Cameron et al. 2007RHv45’- CTGCTGGRGTYCTAGATCC -3’Cameron et al. 2007