A unique new species, Oreocharis scutifolia Z. Xie, Miao Zhang & H. H. Kong, endemic to the Dry and Hot Valley of Jinsha River Basin, Yunnan, China, is described and illustrated here. It is
Table 2. Primers used for molecular phylogeny. NameSequenceGeneDirectionSourceLepF1ATTCAACCAATCATAAAGATATTGGCOIFHebert et al. 2004LCO1490GGTCAACAAATCATAAAGATATTGGCOIRFolmer et al. 1994LepR1TAAACTTCTGG
TABLE 1. Names, sample numbers, localities, and corresponding GenBank accession numbers of the taxa used in the phylogenetic analyses of this study. Newly generated sequences are given in bold text. S
This item includes an ITS sequence alignment of Kluyveromyces spp. strains and a phylogenetic tree based on that alignment. The tree was constructed to determine the species-level identity of strain 2