High-throughput detection of microeukaryotic parasites in insects using Nanopore sequencing

This dataset includes demultiplexed ONT barcode reads and NGSpeciesID outputs from three nanopore sequencing runs targeting the 18S rRNA gene for microeukaryote parasites in insect host. Each run folder contains the following data: Raw demultiplexed ONT reads, represented by barcode folders (Barcode01, Barcode02...). Each Barcode folder contains: Script used to detect primers and generate amplicon sequencing with NGSpeciesID Intermediate fastq files produced by the script Final NGSpeciesID consensus sequences with the naming convention cat_{Primer_sequence}_consensus.fasta (e.g. cat_WL1_GCGCTACCTGGTTGATCCTGCC_EukP3_GACGGGCGGTGTGTAC_consensus.fasta)