rCRUX Generated ITS2 Plants Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name: ITS2 Plants<br> Gene: ITS2<br> Length of Target: 450-550<br> get_seeds_local() minimum length: 315<br> get_seeds_local() maximum length: 600<br> blast_seeds() minimum length: 270<br> blast_seeds() maximum length: 560<br> max_to_blast: 100<br> Forward Sequence (5'-3'): ATGCGATACTTGGTGTGAAT<br> Reverse Sequence (5'-3'): GACGCTTCTCCAGACTACAAT<br> Reference: Gu, W., Song, J., Cao, Y., Sun, Q., Yao, H., Wu, Q., ... &amp; Duan, J. (2013). Application of the ITS2 region for barcoding medicinal plants of Selaginellaceae in Pteridophyta. PloS one, 8(6), e67818. https://doi.org/10.1371/journal.pone.0067818 We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.