Primer pairs used for qualitative and quantitative assessment of anaerobic fungi in New Zealand ruminants.

aNumbering according to Tuckwell et al. [25].bThis primer was tagged with a 40 bp long GC-rich sequence segment (CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG). at the 5′-end when products were to be separated using DGGE, and the primer was then designated ITS400R-GC.cN.D., not done.dAdaptor A followed by a sample-specific barcode was added at the 5′ end of this primer (see Materials and Methods).eAdaptor B was added at the 5′ end of this primer (see Materials and Methods).