rCRUX Generated Teleo Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.

Primer Name:  teleo L1848/H1913
Gene:   12S
Length of Target:    100
get_seeds_local() minimum length:    70
get_seeds_local() maximum length:    130
blast_seeds() minimum length:    40
blast_seeds() maximum length:    100
max_to_blast:  100
Forward Sequence (5'-3'):   ACACCGCCCGTCACTCT
Reverse Sequence (5'-3'):    CTTCCGGTACACTTACCATG
Reference:   Valentini, A., Taberlet, P., Miaud, C., Civade, R., Herder, J., Thomsen, P. F., ... & Gaboriaud, C. (2016). Next‐generation monitoring of aquatic biodiversity using environmental DNA metabarcoding. Molecular Ecology, 25(4), 929-942. https://doi.org/10.1111/mec.13428

We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.