TABLE 1 in A Molecular Systematic Study of the Lampranthus Group (Aizoaceae) Based on the Chloroplast TrnL-trnF and Nuclear ITS and 5 S NTS Sequence Data

TABLE 1. Primer sequences (5′–3′) used in this study for amplification and sequencing of the trnL-F, ITS and 5S gene regions. trnL-F region:c (CGAAATCGGTAGACGCTACG), d (GGGGATAGAGGGACTTGAAC), e (GGTTCA­AGTCCCTCTATCCC), f (TTTGAACTGGTGACACGAG).ITS gene region:ITS 4 (TCCTCCGCTTATTGATATGC), ITS 5 (GGAAGTAAAAGTCGTAACAAGG).5S NTS gene region:P3 (GAGAGTAGTACATCGATGGG), P4 (GGAGTTCTGACGGGATCCGG).