Parental Strand Contributions to recombinants at the polymorphic his4::URA3-ARG4 locus in msh2-del strains

Tetrads were dissected onto YPD agar plates. Entire spore colonies were inoculated into wells of a deep-well 96 well plate containing 500 microliters of YPD broth/well and incubated overnight at 30C with aeration. 400 microliters of each culture was used for DNA preparation and the remainder was archived at -80C. From the DNA preparations the entire 6.865 kb recombination interval was amplified using the following primers: ACGGCACCACTATAAACCCG and GTGGGCTAAAGAACGCGAAC, and Q5 DNA polymerase as recommended by the manufacturer, except that an extension time of 1 min/kb was used to avoid partial synthesis and priming by partial synthesis products. Most of the samples were sequenced on illumine-MiSeq after barcoding with a Nextera-384 barcoding kit (Illumina). The remaining samples were amplified from spore colony DNA using barcodes from (Guo et al, 2015) attached the outer primers listed above, and the entire region was sequenced on a Pacbio RS II instrument. The method of sequencing is indicated in the sample-sheet. In cases where phase was ambiguous, interval DNA from a single colony struck from archived samples was sequenced, initially by Illumina and later by PacBio sequencing (as-indicated).