RNA A>I editing of tau circular RNAs
收藏资源简介:
tau circular RNAs undergo Adenosine to inosine editing, which promotes their translation. To map editing sites,we cotransfected expression constructs for tau 7->12 and 10->12 circRNAs with expression constructs for GFP, ADAR1, ADAR2 and ADAR3 in HEK293 cells. RNA from these transfected cells was isolated and A>I editing was identified by A>G changes in the cDNA. Overall design: 1 µg for the 7->12 circ Tau RNA construct flanked by endogenous introns was 1 µg of expression constructs for either GFP, ADAR1, ADAR2 or ADAR3. Similarly, expression constructs for the 12->10 circRNAs, either flanked by endogenous tau introns or ZKSCAN1 heterologous introns were cotransfected with expression constructs for either GFP, ADAR1, ADAR2 or ADAR3. Total RNA was isolated after 72 hrs using Rnaesy kit (Qiagen) and sequenced using Illumina.Backsplice junctions were searched within raw sequences using zgrep with ATTAATTATCTGCACCTTTTTATTTCCTCC for R1 files or GGAGGAAATAAAAAGGTGCAGATAATTAAT for R2 files. Subsequent read IDs (both read of each positive pair) were used to define new fastq files using the subseq function from seqtk (v1.0-r32). Reads were then aligned to the reference tau circRNA fasta file (including Tag) using Bowtie2 (v2.2.3) and the â--very-sensitive-localâ parameter. Samtools (v1.11) mpileup and pileup2base script were used to study sequence composition at each position. Only positions with A>G and at least 1% of âGâ in one sample were considered.



