ECTOMYC: Impact of Beech transplantation experiment (BTE) on root associated Fungi

The study was conducted in mono-specific European beech (Fagus sylvatica) forests in Central Europe (Germany). Three regions, one in southern Germany (Schwaebische Alb = ALB), one in the middle (Hainich = HAI) and one in the north-east (Schorfheide = SCH) were used to collect beech nuts. The nuts were collected in each region on four plots (ALB plots: were A05s, A07s, A08s, A09s; HAI plots: H10s, H11s, H12s, H06s; and SCH plots: S46s, S05s, S06s, S09s). The collection was conducted in autumn 2011 (28th Sept to 20th Oct) with 30 beechnuts per tree using 100 trees per plot, i.e. resulting in 3000 beech nuts per plot. The beech nuts were germinated after sterilization and grown in sterilized soil. The plants originating from different plots were termed plot-progeny. Ten plants of each plot-progeny were planted into each of nine forest plots per region in fall (September 2012). The plants were grown for 2 years and harvested in summer 2014 (July to August). Since many plants did not survive after out-planting, we selected plots with sufficient plants for harvesting, resulting in 5 plots in ALB (A05, A06, A29, A39, A42), 5 plots in SCH, (S34, S35, S37, S38, S49), and 4 plots in HAI (H05, H12, H16, H21). In addition, roots of on old tree per plot were harvested. This resulted in a total of 182 root samples for analyses of root-associated fungi. The roots were briefly washed and kept frozen at -80 Celsius. The frozen roots with their adhering fungal communities were milled and used for total DNA extraction. Some sample did not yield intact DNA and therefore omitted, resulting in about 170 samples in total. The DNA was purified and amplied (Phusion-Polymerase (Phusion High-Fidelity DNA Polymerase, New England Biolabs GmbH, Frankfurt a. M., Deutschland) using ITS3 KYO2 (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGATGAAGAACGYAGYRAA, Microsynth AG, Balgach, Schweiz) as forward and ITS4 (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC, Microsynth AG, Balgach, Schweiz) as reverse primer. The amplicons were purified with a DNA-Bead-Kit (MagAttract PowerClean DNA Kit, Qiagen, Hilden, Germany) and adjusted to 2 ng microl-1. The samples were sequenced at the Goettingen Genomics Laboratory (Department of Genomic and Applied Microbiology, Griesebachstrasse 8, 37077 Goettingen, Deutschland) on an Illumina MiSeq Instrument.