16S and 18S metabarcoding of gut dysbiosis induced by co-exposition to pesticides and Nosema ceranae in the western honeybee Apis mellifera.. Honeybee microbiota metabarcoding
收藏资源简介:
The sampling was done at D0 on the pollen, the spore solution and the intestinal tract of six introduced workers and six emerging bees. At days 10 and 17, six honeybees were caught in each cage (control, infected, intoxicated or infected and co-intoxicated. Two pools of 3 guts/cage/condition/day were sampled for the DNA/RNA co-extraction which was carried out extemporaneously.RNA samples were reverse-transcribed with random primers using the SuperScript III Reverse Transcriptase kit (Invitrogen™). Amplification of the V3/V4 region of the 16S rDNA and rRNA was performed using the universal primer 515F (5’-GTGYCAGCMGCCGCGGTA-3’) and bacteria/archaea specific primer 909R (5’-CCCCGYCAATTCMTTTRAGT-3’). 18S rRNA gene was amplified with the foward primer fun18S1 (5’CCATGCATGTCTAAGTWAA-3’) and the reverse primer fun18S2 (5’GCTGGCACCAGACTTGCCTCC3’). All primers were modified by adding barcodes. Tagged amplicon pools were constructed in a concentration of 20 ng/µL for Illumina Sequencing Technology (Run type: Paired end-Read length: 2 x 300 bp) by GATC Biotech.



