Note: Indel1 GGGCCCAGCTTCTCAGCAGCAGCCAGGACAAGGGCAACAA (GHYPASQQQPGQGQQ) The Indels were marked by the asterisks “*”. The letters and “*” in parentheses were the substitutions and deletions of amino ac
To quantify variation in repeat content within and between bdelloid species, we generated de novo whole-genome assemblies for 31 rotifer samples encompassing nine species. Three of these assemblies we
BackgroundThe classical candidate-gene approach has failed to identify novel breast cancer susceptibility genes. Nowadays, massive parallel sequencing technology allows the development of studies unaf
