. PCR primers used for both amplification and sequencing. The Dir column identifies forward (F) and reverse (R) primers and indicates external (ex) and internal (in) primers used for nested or hemi-nested PCR. The Ref column lists the reference for the original description of the primer: (1) Maddison 2008; (2) Moore and Robertson 2014; (3) Moulton and Wiegmann 2004; (4) Ober 2002; (5) Simon et al. 1994; (6) Van der Auwera et al. 1994; (7) Vogler and DeSalle 1993; (8) Ward and Downie 2005; (9) Wild and Maddison 2008. in Phylogeny of the supertribe Nebriitae (Coleoptera, Carabidae) based on analyses of DNA sequence data

. PCR primers used for both amplification and sequencing. The Dir column identifies forward (F) and reverse (R) primers and indicates external (ex) and internal (in) primers used for nested or hemi-nested PCR. The Ref column lists the reference for the original description of the primer: (1) Maddison 2008; (2) Moore and Robertson 2014; (3) Moulton and Wiegmann 2004; (4) Ober 2002; (5) Simon et al. 1994; (6) Van der Auwera et al. 1994; (7) Vogler and DeSalle 1993; (8) Ward and Downie 2005; (9) Wild and Maddison 2008.
GenePrimerDirSequenceRef28SLS58FGGGAGGAAAAGAAACTAAC4NLF184/21FACCCGCTGAAYTTAAGCATAT6LS998RGCATAGTTCACCATCTTTC4LS1041RTACGGACRTCCATCAGGGTTTCCCCTGACTTC116S-ND116SARFCGCCTGTTTAACAAAAACAT7ND1ARGGTCCCTTACGAATTTGAATATATCCT5CO1 PJJerFCAACATTTATTTTGATTTTTTGG5PatRTCCAATGCACTAATCTGCCATATTA5CO1 BCLCO1490FGGTCAACAAATCATAAAGATATTGG1HCO2198RTAAACTTCAGGGTGACCAAAAAATCA1wgwg 550FFexATGCGTCAGGARTGYAARTGYCAYGGYATGTC9wg 578FFinTGCACNGTGAARACYTGCTGGATG8wg AbRRinYTCGCAGCACCARTGGAA9wg AbRZRexCACTTNACYTCRCARCACCARTG8CAD2CD398FFGARCAYACAGCNGGNCCNCAAGA3CD581F4FGGWGGWCAAACTGCWYTMAAYTGYGG1CD696RRAANGGRTCNACRTTTTCCATATT2PEPCKPK282FexGAAGGATGGCTBGCNGARCAYATG9PK330FFinGAGGACCAAGCNGAYACNGTDGGTTGTTG9PK485RRGCAGCVGTNGCYTCRCTYCTCAT9TopoTP643FFGACGATTGGAARTCNAARGARATG9TP675FFGAGGACCAAGCNGAYACNGTDGGTTGTTG9TP932RRGGWCCDGCATCDATDGCCCA9