TABLE 1 in Botryosphaeriaceae on palms-a new species of Neodeightonia, N. chamaeropicola, and new records from diseased foliage of ornamental palms in Portugal

TABLE 1. Details of primers used for amplification and sequencing.
Locus 1Primer nameDirectionSequence (5’ → 3’)ReferenceITSITS5ForwardGGAAGTAAAAGTCGTAACAAGGWhite et al. (1990)NL4ReverseGGTCCGTGTTTCAAGACGGO’Donnell (1993)tef1EF1-688FForwardCGGTCACTTGATCTACAAGTGCAlves et al. (2008)EF1-1251RReverseCCTCGAACTCACCAGTACCGtub2T1ForwardAACATGCGTGAGATTGTAAGTO’Donnell & Cigelnik (1997)Bt2bReverseACCCTCAGTGTAGTGACCCTTGGCGlass & Donaldson (1995)
1 ITS: partial cluster of nrRNA genes, including the nuclear 5.8S rRNA gene and its flanking internal transcribed spacer regions ITS1 and ITS2; tef1: partial translation elongation factor 1-alpha gene; tub2: partial beta-tubulin gene.