Lacustrine Microsporidia dynamics over the past 138 years

Despite their ubiquity, the diversity and dynamics of Microsporidia in aquatic ecosystems have long been overlooked. Here, we applied a metabarcoding approach to sedimentary ancient DNA to reconstruct the temporal dynamics of Microsporidia and their eukaryotic hosts over the past 138 years in Lake Aydat (France). We detected remarkably high microsporidian diversity, with 1,976 Operational Taxonomic Units (OTUs). However, 54% of these OTUs could not be assigned at the genus level, indicating substantial, as yet undescribed diversity. The remaining OTUs were affiliated predominantly with three genera: Crispospora, Pseudoberwaldia and Vittaforma.Despite only one formally described species in each of these genera, we show a high species-level diversity forming putative freshwater lake-specific clades, which are likely associated with new hosts. Using co-occurrence network analysis combined with published host records, we identify rotifers as candidate reservoirs for lacustrine Microsporidia. The microsporidian community underwent substantial temporal changes, marked by a major turnover in the early 2000s. This shift coincides with decades of strong anthropogenic pressure on Lake Aydat, including untreated sewage inputs, nutrient enrichment from agro-pastoral activities and wetland destruction. As obligate intracellular parasites, Microsporidia are tightly linked to the ecology and population dynamics of their hosts, suggesting that the observed community shifts primarily reflect changes in host communities. Primers used to amplify the 18S V1-V3 for Microsporidia : V1F (CACCAGGTTGATTCTGCCTGAC) and 530R (CCGCGGCTGCTGGCAC). Primers used to amplify the 18S V4 of Eukaryotes : 515F (GTGYCAGCMGCCGCGGTA) and 951R (TTGGYRAATGCTTTCGC)