Diatom sedimentary ancient DNA metabarcoding from western Fram Strait and Kronotsky Peninsula

In this study we use sedimentary ancient DNA metabarcoding from two marine sediment cores. The first Kastenlot core MSM05/5-712-2 was taken at western Fram Strait (subarctic North Atlantic) from which we collected 12 samples including one biological replicate. The second Kastenlot core SO201-2-12KL was retrieved from Kamchatka Strait (subarctic North Pacific) from which we collected 9 samples and 2 samples were collected from a pilot core taken next to the Kastenlot core. Total DNA was extracted from approximately 2ml sediment per sample in 3 batches with up to 9 samples and one extraction blank. Total DNA was concentrated and if necessary diluted to 2.5 ng/µl. For each batch we performed PCRs in triplicates including a PCR no template control (NTC). We amplified a diatom-specific, 76 bp long part of the rbcL gene with tagged primers Diat_rbcL_705F (AACAGGTGAAGTTAAAGGTTCATAYTT) and Diat_rbcL_808R (TGTAACCCATAACTAAATCGATCAT). The PCR-products were purified and pooled in equal concentrati...