Automatic monitoring of neural activity with single-cell resolution in behaving Hydra

The ability to record every spike from every neuron in a behaving animal is one of the holy grails of neuroscience. Here, we report coming one step closer towards this goal with the development of an end-to-end pipeline that automatically tracks and extracts calcium signals from individual neurons in the cnidarian Hydra vulgaris. We imaged dually labeled (nuclear tdTomato and cytoplasmic GCaMP7s) transgenic Hydra and developed an open-source Python platform (TraSE-IN) for the Tracking and Spike Estimation of Individual Neurons in the animal during behavior. The TraSE-IN platform comprises a series of modules that segments and tracks each nucleus over time and extracts the corresponding calcium activity in the GCaMP channel. Another series of signal processing modules allows robust prediction of individual spikes from each neuron’s calcium signal. This complete pipeline will facilitate the automatic generation and analysis of large-scale datasets of single-cell resolution neural activity..., Generation of transgenic Hydra
 
Following the method previously described, a transgenic Hydra vulgaris (strain AEP) line was established to express GCaMP7s in the cytosol and tdTomato in the nucleus of cells derived from the interstitial stem cell lineage. The plasmid (Addgene catalog no. 102558) was modified by replacing the actin promoter with the EF1-alpha promoter and inserting DsRed downstream of the GCaMP6s sequence. To ensure the nuclear localization of DsRed, a P2A self-cleaving peptide sequence containing a nuclear localizing signal (cccaagaagaagaggaaggtg) was inserted between GCaMP6s and DsRed. The nuclear localization of DsRed was confirmed by electroplating the plasmid into Hydra. To enhance fluorescence intensity, GCaMP6s was replaced with jGCaMP7s and DsRed was replaced with tdTomato. Finally, for microinjections, the EF1-alpha promoter was replaced with the Actin promoter. All fluorescent reporter gene sequences were codon optimized specifically for Hydra. Standard embry..., , # Automatic monitoring of whole-body neural activity in behaving Hydra

## Description of the file structure

There are three sets of movies, all in .avi format.

##### Set 1: Non-contracting Hydra

* This set contains movies from three different Hydra. Each Hydra is associated with two separate movies, one cytoplasmic GCaMP7s movie and one nuclear tdTomato movie. The .avi files are labeled as follows:

* Hydra 1: G7_nocontrxn-1.avi, tdT_nocontrxn-1.avi
* Hydra 2: G7_nocontrxn-2.avi, tdT_nocontrxn-2.avi
* Hydra 3: G7_nocontrxn-3.avi, tdT_nocontrxin-3.avi

##### Set 2: Contracting Hydra

* This set also contains movies from three different Hydra. Each Hydra is associated with two separate movies, one cytoplasmic GCaMP7s movie and one nuclear tdTomato movie. The .avi files are labeled as follows:

* Hydra 1: G7_contrxn-1.avi, tdT_contrxn-1.avi
* Hydra 2: G7_contrxn-2.avi, tdT_contrxn-2.avi
* Hydra 3: G7_contrxn-3.avi, tdT_contrxin-3.avi
...