qPCRs runned in OPUS96.7z

The RNA samples of the different life cycle stages of T. cruzi were obtained from: A) Epimastigotes cultured in LIT-10 % FBS-5 μM hemin medium supplemented with or without 250 μM Cu, 500 μM BCS or 1 μM NeoCup. After 2 days, the cells were collected. B) Metacyclic trypomastigotes obtained by incubation of epimastigotes in LIT-10 % FBS-5 μM hemin pH 6 media. After 7 days, cells were collected and trypomastigotes were separated from remaining epimastigotes using DEAE-cellulose as described (https://doi.org/10.1016/j.mimet.2017.08.021). C) Cell-derived trypomastigotes collected from the supernatant of infected Vero cells 5 days post infection. D) Amastigotes obtained from infected monolayers of Vero cells maintained in DMEM-2 % FBS supplemented with 100 μM Cu,0.02 μM NeoCup or without supplementation at 72 h post infection, when the mammalian cells were washed twice with cold PBS and lifted with a cell scraper in 5 mL PBS. Then, the collected cells were suspended in 1 mL PBS and lysed by a 27G syringe. The released amastigotes were concentrated and separated from Vero cell debris by centrifugation. In all cases, 100 x 106 parasites were used for RNA extraction using 1 mL TRIREAGENT (TR118 - Molecular Research Center, Inc.). The quality of RNA was verified in agarose gels and quantified by absorbance. The RNA samples were treated with DNAse (RQ1 Rnasa-Free Dnase, PROMEGA) and retrotranscribed with FireScript KIT Reverse Transcriptase (Solis BioDyne) to obtained cDNA. The quantitative Real Time PCR reactions were performed with HOT FIREPol EvaGreen qPCR Mix Plus (ROX) (Solis BioDyne), using the primers listed below, in the CFX Opus 96 Real-Time PCR System (#12011319 - BioRad) following the next protocol: 95 °C (10 min); 40 cycles of 95 °C (10 s), 60 °C (30 s), and 72 °C (20 s); followed by the denaturation curve to analyze the Tm of the products.
Analyzed genes: TcFR (TcFR18): BCY84_13742, BCY84_13743, BCY84_05177, BCY84_05181, BCY84_05183, BCY84_05184. TcIT: BCY84_01266, BCY84_15905. TcCuATPase: BCY84_03133, BCY84_03134, BCY84_03135. TcFet3: BCY84_15293. TcUbiquitin (Ubiq) (housekeeping): BCY84_18965
Primers: Fw_qTcFR CTGTCGTTGCTCATGTTTCC, Rv_qTcFR TTTGTGGACCCAGATCGAAG, Fw_qTcIT AGCGCGAAACGTATCATTGC, Rv_qTcIT CCGCGTCTGGGAATCATTTG, Fw_qTcCuATPase CGGATGTGGATGAACAGATGG, Rv_qTcCuATPase GGCGCAAAATCTGAGACAAC, Fw_qTcFet3 TTTCCACGTTGCTGCCATTG, Rv_qTcFet3 TCTTCACATACCGCCACCAC, Fw_qTcUbiquitin AGGGCATTCCGGGAAAGATG, and Rv_qTcUbiquitin CCACCACCATGTGCAGAGTT.
Samples: E or Epis : epimastigotes. A: Amastigotes. Tc: cell derived trypomastigotes. TM: metacyclic trypomastigotes. ACu: Amastigotes treated with 100 μM Cu. ANeo: Amastigotes treated with 0.02 μM. NeoCup. E250 or E Cu: epimastigotes treated with 250 μM Cu. ENeo1 or EN1: epimastigotes treated with 1 μM NeoCup. E500: epimastigotes treated with 500 μM BCS.
Reagents: The experiments were done using T. cruzi Dm28c strain. T. cruzi epimastigotes were maintained in mid-log phase by periodic dilutions in Liver Infusion Tryptose (LIT) medium (5 g/L liver infusion broth, 5 g/L bacto-tryptose, 68 mM NaCl, 5.3 mM KCl, 22 mM Na2HPO4, and 0.8 % (w/v) glucose, pH 7.4) supplemented with 10 % FBS and 5 μM hemin (LIT-10 % FBS-5 μM hemin medium), at 28 °C. Fetal Bovine Serum (FBS) was obtained from Internegocios S.A. (Buenos Aires, Argentina) and heat-inactivated at 56 °C for 30 min. Hemin (Frontier Scientific #H651-9) stock solution (1 mM) was prepared in 50 % (v/v) EtOH, 0.01 M NaOH, fractionated and stored at −80 °C. (Liver Infusion Broth BD DIFCO™ # 226920, GranuCult® prime Tryptose Broth Millipore #1.03866). Copper (Cu) was added as Cu2+ from CuSO4 salt. Bathocuproine disulfonate (BCS, an extracellular copper chelator). Neocuproine solution (NeoCup, an intracellular copper chelator) was prepared from Neocuproine hydrochloride monohydrate (Supelco # 72090). Authors: Maria G. Mediavilla, Marcelo L. Merli, and Julia A. Cricco