Corneal endothelial cells proliferation uncoated, collagen and Matrigel-coated plates

Six corneal endothelia were obtained by surgical dissection from 3-month-old White New Zealand rabbit eyes, a section of 5 mm2 of each tissue was cultured directly in proliferative medium (OptiMEM I 8% FBS, 5 ng/mL EGF, 20 ng/mL NGF, 20 μ g/mL ascorbic acid, 0.08% chondroitin sulfate, 200 μ g/mL CaCl2, and antibiotics) until confluence (~15 days). The explant was removed after 7 days, when CEC growth was seen. Each confluent CEC plate were splitted in three plates and cultured in basal medium (OptiMEM I 8% FBS and antibiotics) until confluence. Morphological changes in each culture condition (Matrigel, Collagen I, and no coating in proliferative or basal medium) were registered with an Axiovert 40 CFL inverted microscope (Zeiss, Germany) with a Power Shot A640 digital camera (Canon, USA). Immunocytochemistry was performed to analyze the presence of GPC4 and Na/K-ATPase in CEC cultured in each condition. Images were obtained with a fluorescence inverted microscope ImagerZ.1 (Zeiss, Germany), equipped with a AxioCam HRm (Zeiss, Germany) and software Axiovision 4.6 (Axio Vs 40V4.6.1.0 Carl Zeiss Imaging Solutions GmH, Germany).<br>RNA was isolated from CEC cultured in basal medium to analyze the expression of GPC4, CD200, and TJP1 by RT-PCR. GAPDH gene was used a s constitutive control.A Step One Real-time PCR System (Applied Biosystems by Life Technologies, Singapore) was used for final point PCRs of specific CECs markers GPC4 (Fw CGCCAAATCATGGCTCTTCG, Rv GGCACTGCTGGTACTCACAT), TJP1 (Fw TGCCTCCGAGAGAGATGACA, Rv CGCCAGCCACAAATATTCCG) and CD200 (Fw TTCGGGAGGCCCTTCTATCA, Rv CATCCTGGGTCACCACTTCC); housekeeping gene used was GAPDH (Fw CGAGCTGAACGGGAAACTCA, Rv CCCAGCATCGAAGGTAGAGG). Four cycles of preamplification (1:30 min 95°C, 30 s 64°C, 45 s 72°C) were followed by 30 amplification cycles (30 s 95°C, 30s; 57°C, 45 s 72°C) and a 5-min extension at 7°C. Electrophoresis of PCR products was performed in a 2% agarose gel, 140V in sodium borate buffer. <br>