rCRUX Generated Taberlet c/h trnl Reference Database
收藏资源简介:
rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name: Taberlet c/h trnl<br> Gene: trnl<br> Length of Target: 150<br> get_seeds_local() minimum length: 105<br> get_seeds_local() maximum length: 150<br> blast_seeds() minimum length: 85<br> blast_seeds() maximum length: 128<br> max_to_blast: 100<br> Forward Sequence (5'-3'): CGAAATCGGTAGACGCTACG<br> Reverse Sequence (5'-3'): CCATTGAGTCTCTGCACCTATC<br> Reference: Taberlet, P., Gielly, L., Pautou, G., & Bouvet, J. (1991). Universal primers for amplification of three non-coding regions of. Plant molecular biology, 17, 1105-1109. & Taberlet, Pierre, Eric Coissac, François Pompanon, Ludovic Gielly, Christian Miquel, Alice Valentini, Thierry Vermat, Gerard Corthier, Christian Brochmann, and Eske Willerslev. "Power and limitations of the chloroplast trn L (UAA) intron for plant DNA barcoding." Nucleic acids research 35, no. 3 (2007): e14-e14. We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.



