rCRUX Generated Fungal ITS Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name: Fungal_ITS gITS7/ITS4<br> Gene: FITS<br> Length of Target: 150-330<br> get_seeds_local() minimum length: 105<br> get_seeds_local() maximum length: 500<br> blast_seeds() minimum length: 65<br> blast_seeds() maximum length: 461<br> max_to_blast: 100<br> Forward Sequence (5'-3'): GTGARTCATCGARTCTTTG<br> Reverse Sequence (5'-3'): TCCTCCGCTTATTGATATGC<br> Reference: White, T. J., Bruns, T., Lee, S., &amp; Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications, 18(1), 315–322.<br> Ihrmark, K., Bödeker, I., Cruz-Martinez, K., Friberg, H., Kubartova, A., Schenck, J., Strid, Y., Stenlid, J., Brandström-Durling, M., &amp; Clemmensen, K. E. (2012). New primers to amplify the fungal ITS2 region–evaluation by 454-sequencing of artificial and natural communities. FEMS Microbiology Ecology, 82(3), 666–677. https://doi.org/10.1111/j.1574-6941.2012.01437.x We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.