Single-Molecule MicroRNA Electrochemiluminescence Detection Using Cyclometalated Dinuclear Ir(III) Complex with Synergistic Effect

The realization of electrochemiluminescence (ECL) detection
at
the single-molecule level is a longstanding goal of ECL assay that
requires a novel ECL probe with significantly enhanced luminescence.
Here, the synergistic effect of electrochemiluminescence (ECL) is
observed unprecedentedly in a new cyclometalated dinuclear Ir­(III)
complex [Ir2(dfppy)4(imiphenH)]­PF6 (1·PF6, PF6– = hexafluorophosphate) in which two {Ir­(dfppy)2}+ units are bridged by an imiphenH– ligand.
The ECL intensity from complex 1·PF6 is
4.4 and 28.7 times as high as that of its reference mononuclear complexes 2 and 3·PF6, respectively. Theoretical
calculation reveals that the S0 to S1 excitation
is a local excitation in 1·PF6 with two
electron-coupled Ir­(III) centers, which contributes to the enhanced
ECL. The synergistic effect of ECL in 1·PF6 can be used to detect microRNA 21 at the single-molecule level (microRNA
21: UAGCUUAUCAGACUGAUGUUGA), with detectable ECL emission from this
complex intercalated in DNA/microRNA 21 duplex as low as 90 helix
molecules. The finding of the synergistic effect of ECL will not only
provide a novel strategy for the modulation of ECL intensity but also
enable the detection of microRNA at the single-molecule level.