five

Sensitivity to habitat fragmentation across European landscapes in three temperate forest herbs

收藏
NIAID Data Ecosystem2026-03-12 收录
下载链接:
http://datadryad.org/dataset/doi%253A10.5061%252Fdryad.tb2rbp00k
下载链接
链接失效反馈
官方服务:
资源简介:
Context. Evidence for effects of habitat loss and fragmentation on the viability of temperate forest herb populations in agricultural landscapes is so far based on population genetic studies of single species in single landscapes. However, forest herbs differ in their life histories, and landscapes have different environments, structures and histories, making generalizations difficult. Objectives. We compare the response of three slow-colonizing forest herbs to habitat loss and fragmentation and set this in relation to differences in life-history traits, in particular their mating system and associated pollinators. Methods. We analysed the herbs’ landscape-scale population genetic structure based on microsatellite markers from forest fragments across seven European agricultural landscapes. Results. All species responded to reductions in population size with a decrease in allelic richness and an increase in genetic differentiation among populations. Genetic differentiation also increased with enhanced spatial isolation. In addition, each species showed unique responses. Heterozygosity in the self-compatible Oxalis acetosella was reduced in smaller populations. The genetic diversity of Anemone nemorosa, whose main pollinators are less mobile, decreased with increasing spatial isolation, but not that of the bumblebee-pollinated Polygonatum multiflorum. Conclusions. Our study indicates that habitat loss and fragmentation compromises the long-term viability of slow-colonizing forest herbs despite their ability to persist for many decades by clonal propagation. The distinct responses of the three species studied within the same landscapes confirm the need of multi-species approaches. The mobility of associated pollinators should be considered an important determinant of forest herbs’ sensitivity to habitat loss and fragmentation. Methods The allele data originate from 42, 34 and 36 populations of Anemone nemorosa, Oxalis acetosella and Polygonatum multiflorum, respectively, sampled in seven 5 x 5 km² landscape windows across Europe (North France, Belgium, West Germany, East Germany, South Sweden, Central Sweden,  Estonia). A population is defined as a spatially distinct group of shoots >100 m apart from other shoots. Typically, populations covered the whole forest patch, but were in some cases restricted to certain parts of a forest patch if habitat conditions were heterogeneous. From each plant population, we randomly collected leaf material from up to 20 flowering, healthy individuals spread across the population for DNA extraction. A minimum distance of 10 m between selected plants was set to avoid sampling of clones. Fewer than 20 samples per population were available in 29.5% of the populations either due to genotyping failures or due to a very small population size. Leaf samples were dried and stored using silica gel. Total genomic DNA was extracted with the innuPREP Plant DNA Kit (Analytik Jena AG, Germany). We genotyped our samples based on sets of microsatellite markers using different PCR protocols (see below). Fragment analysis was performed on a 3730XL DNA analyzer (Applied Biosystems, USA) by Macrogen Europe (Amsterdam, Netherlands) with GeneScan 500 LIZ (Applied Biosystems) for A. nemorosa and P. multiflorum and GeneScan 350 ROX (Applied Biosystems) for O. acetosella as an internal size standard. Alleles were manually scored using GeneMapper 5 (Applied Biosystems). Anemone nemorosa was treated as tetraploid, the other two species as diploid. For a stratified random subsample of 10% from all landscapes, we repeated genotyping to estimate the multilocus genotyping error rate, which turned out to be 4.8%, 2.8% and 5.7% for A. nemorosa, O. acetosella and P. multiflorum, respectively. Repeated multilocus genotypes were removed from the data. The final number of samples amounts to 804, 519 and 625 for A. nemorosa, O. acetosella and P. multiflorum, respectively. Anemone nemorosa Table 1 Microsatellite markers used to genotype samples of A. nemorosa. The markers were developed for A. amurensis by Sun et al. (2012) Locus Primer sequences (5'-3') Repeat Size (bp) Ta (°C) Na BH84 F: TTGCCATGGACCAATACTCG (TG)9 161-203 48 22   R: GTCAGTGCAAGAAAGTAGCTGC         BH206 F: TGTTGTTTCCCTTACTTGCC (GT)22A(TG)14 113-167 48 27   R: CATCTTATGTCACACTTGGG         BH235 F: CATGGCCATTGGTATCAAAC (GT)5A(TG)16 144-190 48 22   R: TTGGTGGAACAACTTAGCCC         HS27 F: GGAAGCATCATCTCACCTAC (AC)7 173-183 50 4   R: TTCTAGTTTTGACTGGGAGG         HS177 F: GAAAATGTGACCGTCCCTAC (AC)7 192-210 48 8   R: TGTCATTGGCTCACCACCTT         HS256 F: CTGTTCCTCCGATGGCGTTT (TG)7 214-254 50 19   R: ACCTTACCCTTCCCCTCTTC                 Mean 17.0         Sum 102               Multiplex PCRs were performed in a final reaction volume of 15 µl, containing 0.5 µl of DNA (ca. 10-30 ng/µl), 7.5 µl of QIAGEN Multiplex PCR Plus Kit (100), 5.5 µl of H2O and 1.5 of µl primer mix. Singleplex PCRs were performed in a final reaction volume of 10 µl, containing 0.5 µl of DNA (ca. 10-30 ng/µl), 5 µl of QIAGEN Multiplex PCR Plus Kit (100), 3.5 µl of H2O and 1 µl primer mix. The primer mix for both singleplex and multiplex PCR contained 1 μl of each forward primer (labelled with fluorescent dye; stock solution concentration 100 pmol), 1 μl of each reverse primer and 98 μl of H2O per 100 µl. A double PCR with the same primer set was done for samples with a low quality of DNA (A260/A230 < 1.5 and A260/A280 < 1.75) that did not result in countable banding patterns after a single PCR. Here, we conducted the first PCR as described above and a second PCR with the same conditions but with 0.5 µl of the PCR product of the first run as template. For all loci, we applied the following standard PCR program: Step Initial denaturation Denaturation Annealing Primer extension final extension Time (min) 5:00 0:30 1:30 0:30 10:00 T (°C) 95 95 Ta 72 68     35 cycles             Oxalis acetosella Table 2 Microsatellite markers used to genotype samples of O. acetosella. The markers were developed by AllGenetics & Biology SL (www.allgenetics.eu) based on eight of our samples Locus Primer sequences (5'-3') Repeat Size (bp) Ta (°C) Na Oac111 F: CGTCATCTACACTCGTCGGA (AG)7 172-178 57/53* 7   R: GGCTAGGAGAGGTCGGAGTC         Oac113 F: TCCATCATCTCACACGCTTC (AG)6 218-224 57/53 3   R: TTTGCTGGTGAAATGACGAC         Oac114 F: TGGCACCATGTCATCATCTT (AG)8 112-118 57/53 3   R: TTGTATTGTCGTGGACGGAG         Oac159 F: CCCTGGTATCACGCATTTCT (AG)10 124-164 57/53 13   R: AGGTGGTGTCTGTGGAGGAT         Oac167 F: CCAAGAAATTCGGGTTGTTG (AAG)6 166-181 57/53 6   R: CTTACACGTTGCTCCTCCGT         Oac181 F: CCTTAGCAAGCTCCATCACC (AG)8 130-134 57/53 3   R: GTTCTGTGCTTAATGCGACG         Oac306 F: GTCAGTGCCACATCAGCTTG (AC)8 201-225 57/53 2   R: CCGTAAGAAACGGATCCAAC         Oac450 F: TCGCTAATGCGCAGATTTC (AAG)9 150-265 57/53 22   R: CATGCGCCTTTGCATTATTA         Oac466 F: CGATCAATCTGCGACAAGAA (AG)6 112-123 57/53 2   R: GGAGAGTCGGTGGGAGTTC                 Mean 6.8         Sum 61             *See PCR protocol below for applied annealing temperatures. For all loci, PCRs were performed in a final reaction volume of 12.5 µl, containing 1 µl of DNA (ca. 50-100 ng/µl), 6.25 µl QIAGEN Multiplex PCR Plus Kit (100), 4 µl of H2O and 1.25 µl of primer mix. The primer mix for a singleplex PCR contained 2 μl of forward primer (stock solution concentration 100 pmol), 0.2 μl of reverse primer (with an oligonucleotide tail at its 5’ end), 2 µl of fluorescent-labelled oligonucleotide (identical to the 5’ tail of the reverse primer) and 95.8 μl of H2O per 100 µl. The oligonucleotide tails used were the universal sequences M13 (GGA AAC AGC TAT GAC CAT), CAG (CAG TCG GGC GTC ATC), and T3 (AAT TAA CCC TCA CTA AAG GG). The three oligonucleotides were labelled with the HEX dye, the FAM dye, and the TAMRA dye, respectively. During the first cycles of the PCR, the reverse primer with the tail is incorporated into the accumulating PCR products. When this primer is used up, the annealing temperature is lowered, so the fluorescently labelled M13, CAG, or T3 oligonucleotide can anneal and start acting as a primer. For all loci, we applied the following standard PCR program: Step Initial denaturation Denaturation Annealing Primer extension Denaturation Annealing Primer extension final extension Time (min) 5:00 0:30 1:30 0:30 0:30 1:30 0:30 15:00 T (°C) 95 95 57 72 95 53 72 68     35 cycles     8 cycles             Polygonatum multiflorum Table 3 Microsatellite markers used to genotype samples of P. multiflorum. The markers were developed for P. cyrtonema by Cheng et al. (2010) and for P. filipes by Liu et al. (2010) Locus Primer sequences (5'-3') Repeat Size (bp) Ta (°C) Na Source Pc1 F: CTCTCCTATCGGCAGCAACT G8(GA)32 184-198 54 6 Cheng et al. 2010   R: ACTTCCTCCATCCTTACACCAT           Pc17 F: GGACACCCGAAGAAATACAAG (AG)40 146-242 52 44 Cheng et al. 2010   R: CCAATTGCCTCCTTCACATC           Pc25 F: CTCCCTTTCCCAATCCCGT (CT)8CC(CT)18(TA)5 210-262 52 24 Cheng et al. 2010   R: CCCAACATCTCGTAGTCGCAA           Pc33 F: CGCACCCAGACCGAGAAA (GA)34 228-280 54 25 Cheng et al. 2010   R: GTAGGCAAGGAACACCCACAC           Pt9 F: ATGATGAGACCATAGGCGACT (GA)39 126-216 54 45 Liu et al. 2010   R: GACGACTACGATGTCACCG           Pt11 F: GGGGCTGCTGCTAGGGTAT (GA)26 135-187 54 5 Liu et al. 2010   R: TCGCCTGTCACTGGATTGC                   Mean 24.8           Sum 149                   For all loci, PCRs were performed in a final reaction volume of 15 µl, containing 1 µl of DNA (ca. 10-30 ng/µl), 7.5 µl of QIAGEN Multiplex PCR Plus Kit (100), 5 µl of H2O and 1.5 of µl primer mix. The primer mix for a singleplex PCR contained 1μl of forward primer (labelled with fluorescent dye; stock solution concentration 100 pmol), 1 μl of reverse primer and 98 μl of H2O per 100 µl. For all loci except Pc17 and Pt9, we applied the following standard PCR program: Step Initial denaturation Denaturation Annealing Primer extension final extension Time (min) 5:00 0:30 1:30 0:30 15:00 T (°C) 95 95 Ta 72 68     35 cycles         For Pc17 and Pt9, the annealing and extension time were extended to avoid large allele dropout: Step Initial denaturation Denaturation Annealing Primer extension final extension Time (min) 5:00 0:30 1:45 0:45 15:00 T (°C) 95 95 Ta 72 68     35 cycles         References Cheng WJ, Liu TT, Wu HL, Zhou SB, Xuan SQ, Zhu GP (2010) Isolation and characterization of twelve polymorphic microsatellite loci in Polygonatum cyrtonema and cross-species amplification. Conserv Genet Resour 2:105-107. https://doi.org/10.1007/s12686-010-9218-1 Liu TT, Cheng WJ, Zhou SB, Shao JW, Wu HL, Zhu GP (2010) Eleven polymorphic microsatellite loci in Polygonatum filipes and cross-amplification in other congeneric species. Conserv Genet Resour 2:77-79. https://doi.org/10.1007/s12686-010-9179-4 Sun MZ, Yin X, Shi FX et al (2012) Development of eighteen microsatellite markers in Anemone amurensis (Ranunculaceae) and cross-amplification in congeneric species. Int J Mol Sci 13(4):4889-4895. https://doi.org/10.3390/ijms13044889
创建时间:
2021-06-30
二维码
社区交流群
二维码
科研交流群
商业服务