Additional file 4: Table S1. of Glyceollins trigger anti-proliferative effects through estradiol-dependent and independent pathways in breast cancer cells

All differentially expressed genes. The ID of all genes are indicated with their functions and expression levels. Cell cycle analysis. MCF-7 cells (100,000 cells/well) were plated in 6-well plates. After 72 h of serum and steroid deprivation, the cells were treated for 72 h with solvent as control, 10−9 M E2, 10−5 M glyceollin I or II, or a combination of E2 and glyceollin I or II. Then, the cells were trypsinized and fixed in 70% ethanol before staining with propidium iodide. The percentage of cells in each cell cycle phase was assessed by flow cytometry with a FACS Calibur (BD Biosciences). Measurement of apoptosis MCF-7 cells (4000 cells/well) were plated in 96-well plates. After 72 h of serum and steroid deprivation, the cells were treated for 72 h with solvent as control, 10−9 M E2, 10−5 M glyceollin I or II, or a combination of E2 and glyceollin I or II. TUNEL staining was assessed with an In Situ Cell Death Detection Kit, Fluorescein (Roche) according to the manufacturer’s instructions. The fluorescence and percentage of TUNEL-positive cells were determined with an Array Scan VTI (Thermo Fisher Scientific) on the ImPACcell platform (Rennes, France). Chromatin Immunoprecipitation (ChIP) MCF-7 cells (2,000,000 cells /dishes) were plated in 10 cm dishes and then deprived of steroids and serum for 72 h. The cells were treated for 1 h with 10−9 M E2, with 10−5 M GI or GII with or without 10−9 M E2. Then, cells were cross-linked for 10 min with 1.5% of formaldehyde (Sigma). Cells were lysed in lysis buffer (50 mM Tris-HCl, pH 8.1, 10 m M EDTA, 0.5% Empigen BB and 1% SDS). Chromatin was sonicated 10 min (15 s on/off cycles) on Bioruptor (Diagenode) at highest intensity. Soluble chromatin was diluted in IP buffer (20 mM Tris-HCl, pH 8.1, 2 mM EDTA, 0.1% Triton X-100) with 2 μg of ERα antibody (E115, Abcam) and yeast RNA as non-specific competitor and incubated overnight at 4 °C on rocking platform. Then, protein G coupled sepharose beads were added to the samples and were incubated 4 h à 4 °C. Immune complexes were washed one time in washing buffer 1 (20 mM Tris-HCl, pH 8.1, 2 mM EDTA, 150 mM NaCl, 1% Triton X-100 and 0.1% SDS), one time in washing buffer 2 (20 mM Tris-HCl, pH 8.1, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100 and 0.1% SDS), one time in washing buffer 3 (10 mM Tris-HCl, pH 8.1, 1 mM EDTA, 250 mM LiCl, 1% Deoxycholate and 1% NP-40) and finally two times in washing buffer 4 (10 mM Tris-HCl, pH 8.1, 1 mM EDTA). After washing, immune complexes were extracted with 100 μl of extraction buffer (0.1 M NaHCO3 and 1% SDS). Cross-linking was reverse by incubation of samples overnight at 65 °C and DNA was purified using the Nucleospin Gel and PCR cleanup kit (Macherey Nagel). Enrichment analysis on the ERE proximal of GREB1 (Fwd: CACTTTGAGCAAAAGCCACA and Rev.: GACCCAGTTGCCACACTTTT) and on an enhancer 1 of PgR described in [58] was normalized using an irrelevant region on the chromosome 10 (Fwd: AGGTGACAAGCCAAGTGTCC and Rev.: GCCTGGTGGCATACTAAAGG). Analysis was performed by real time PCR on a CFX 384 apparatus (BioRad) on 2 μL of immunoprecipitation or 0.2 μL of input with 500 nM of primers and iTaq Universal SYBR Green Supermix (BioRad). (XLSX 590 kb)