Ramazzottius claudii draft genome assembly
收藏资源简介:
Data associated with Vecchi & Stec.Mitogenome of a new Ramazzottius species (Tardigrada: Eutardigrada: Ramazzottiidae) discovered in rock pools along with its Temperature and Desiccation-Related Proteins repertoire. Draft assembly of Ramazzottius claudii genome obtained of sequencing after WGA (REPLI-g Mini Kit Cat. No. 150023, Qiagen) and debranching with T7 Endonuclease I (Cat. No. M0302, New England Biolabs). Sequencing was performed on a Nanopore MinION with a R10 chemistry flowcell using fast basecalling. Assembly has been done with Flye v 2.9.3 and polished with medaka v 1.11.3 (-m r1041_e82_400bps_fast_g615). Library prep for Nanopore sequencing was done with Native Barcoding Kit 24 V14 (SQK-NBD114.24) using Native Barcode 01 NB01 (in the same flowcells samples with NB02 and NB03 were also run). NB sequences are reported below. This draft genome should be used with caution as it may still contain contaminant sequences. The raw reads can be found in NCBI under BioProject PRJNA1082523, accession number SRR28173874. NB01 F CACAAAGACACCGACAACTTTCTT NB01 R AAGAAAGTTGTCGGTGTCTTTGTG NB02 F ACAGACGACTACAAACGGAATCGA NB02 R TCGATTCCGTTTGTAGTCGTCTGT NB03 F CCTGGTAACTGGGACACAAGACTC NB03 R GAGTCTTGTGTCCCAGTTACCAGG



