TABLE 2 in The westernmost known population of Paracobitis (Teleostei, Nemacheilidae), with the description of a new species from the Euphrates River in southern Anatolia

TABLE 2. Variable nucleotide substitutions in the 652 base pairs long mt DNA COI barcode region of Paracobitis salihae and its most closely-related congener Paracobitis zabgawraensis. Species, Locality, Genbank numberVariable nucleotides positions111233 4778679822 90920890253333444444 2489004899 80380984065555556 0355884 5504390P. salihae Euphrates MT651606TGGCAGACGGGGCTAGAAGAATACAGTP. zabgawraensis Tigris MK238776AAA.GAGTA.AATCTAGGAGGCGTGA.P. zabgawraensis Great Zab KJ723497AA.T.AGTAAAATCTAGGAG.C.T.A-P. zabgawraensis Great Zab KJ723514AA.T.AGTAAAATCTAGGAG.C.T.AC