PCR primers and probe used in this study.

Quantitative real time PT-PCR was performed in the Applied Biosystem StepOnePlus™ (Appleid Biosystems), using TaqMan® Fast Advanced Master Mix (Appleid Biosystems) and specific primers and probe for TNF-α (Forward: CCAAATGGCCTCCCTCTCAT, Reverse; GCTACAGGCTTGTCACTCGAATT, Probe; 5’-FAM-CCCAGACCCTCACACACTCAGATCATCTTC-TAMRA-3’) and MCP-1 (Forward: GCTGGAGAGCTACAAGAGGATCAC, Reverse; TGGTTCCGATCCAGGTTTTTA Probe; 5’-FAM-CAGCAGGTGTCCCAAAGAAGCTGTAGTTTTT-TAMRA-3’). Reaction product was quantified with 18S (X03205.1 Eukaryotic 18S rRNA; Appleid Biosystems) as the reference gene.PCR primers and probe used in this study.