Pollinator data from: Pollinator movement activity influences genetic diversity and differentiation of spatially isolated populations of clonal forest herbs
收藏资源简介:
In agricultural landscapes, forest herbs live in small, spatially isolated forest patches. For their long-term survival, their populations depend on animals as genetic linkers that provide pollen- or seed-mediated gene flow among different forest patches. However, whether insect pollinators serve as genetic linkers among spatially isolated forest herb populations in agricultural landscapes remains to be shown. Here, we used population genetic methods to analyze: (A) the genetic diversity and genetic differentiation of populations of two common, slow-colonizing temperate forest herb species (Polygonatum multiflorum (L.) All. and Anemone nemorosa L.) in spatially isolated populations within three agricultural landscapes in Germany and Sweden and (B) the movement activity of their most relevant associated pollinator species, i.e., the bumblebee Bombus pascuorum (Scopoli, 1763) and the hoverfly Melanostoma scalare (Fabricus, 1794), respectively, which differ in their mobility. We tested whether the indicated pollinator movement activity affected the genetic diversity and genetic differentiation of the forest herb populations. Bumblebee movement indicators that solely indicated movement activity between the forest patches affected both genetic diversity and genetic differentiation of the associated forest herb P. multiflorum in a way that can be explained by pollen-mediated gene flow among the forest herb populations. In contrast, movement indicators reflecting the total movement activity at a forest patch (including within-forest patch movement activity) showed unexpected effects for both plant-pollinator pairs that might be explained by accelerated genetic drift due to enhanced sexual reproduction. Our integrated approach revealed that bumblebees serve as genetic linkers of associated forest herb populations, even if they are more than 2 km apart from each other. No such evidence was found for the forest-associated hoverfly species which showed significant genetic differentiation among forest patches itself. Our approach also indicated that a higher within-forest patch movement activity of both pollinator species might enhance sexual recruitment and thus diminishes the temporal buffer that clonal growth provides against habitat fragmentation effects. Methods The study was conducted in three 5 km x 5 km landscape windows within typical Central European agricultural landscapes in western Germany, eastern Germany, and southern Sweden. In each landscape window, pollinator individuals were collected in six deciduous forest patches, in which we also collected leaf material of forest herbs. The pollinators were captured by a combined design of Malaise traps and observations and stored in 70% ethanol with 10% isopropanol. Total genomic DNA of the insects was extracted using the E.Z.N.A. Tissue DNA Kit (OMEGA Bio-Tek, USA) according to the manufacturer’s protocol. We genotyped our samples based on sets of microsatellite markers using different PCR protocols (see below). The fragment length analyses were performed on a 3730xl DNA analyzer (Applied Biosystems, USA) by MACROGEN Europe (Amsterdam, Netherlands) with GeneScan ROX 350 as the size standard for M. scalare and GeneScan LIZ 500 for B. pascuorum. Ten percent of the individuals of each species were genotyped for a second time to quantify the error rate. For all species, the locus-specific error rate never exceeded 5% (mainly due to allelic dropout). For Melanostoma scalare Table S5.1: Primer sequences of sixteen new developed (AllGenetics & Biology SL, Spain) microsatellite loci for the hoverfly species M. scalare. mono: Monomorphic primers. Locus Forward Primer Reverse Primer AG Msc 009 TGAAGTTGCAGTCAACCAGC TGCATGACTGGCTATGTGGT AG Msc 012 ATTCCGAGTACATCAACCGC CAGGGCTTTACCAATGGTGT AG Msc 065 CAATGCAACTCCCTCTGACA TGTAGCATGTGGCTAATGGC AG Msc 073 ATTTCAATACGTGCGGGTGT ACGCGACCTAAATGACGACT AG Msc 082 GAGGAAACGCACTGAGGAAG TAATACAACCAGCCAGCCGT AG Msc 111 TAGCCATCAATTGCCGAGAT TCCAATAGTTCGTTCGACCC AG Msc 117 mono CATCAGCATTGTAACCCGTG CAGGCGTTGTTGAGTTATGC AG Msc 120 CATCGACCTCTGCTCTCGTT ATTACACCTTCTATGCGGCG AG Msc 130 GACAGGAAATCAAAGGCGAA GTAGCTCAGCGGATGGAGAA AG Msc 167 TAGTCCAGCAGCTGAGTTCG GGGAGAGTTGTGATCGCTTC AG Msc 229 CTGGTCGGTCAAAGAGAAGG ATTACACGCATCCTGTTGGC AG Msc 290 CCTACTGAGATTTGGCCACC GCCGGTATAACGATAACGCA AG Msc 324 TGGTTGACAGGAGCTTCAAA CGACGAAGACAGGACCAAAG AG Msc 344 mono GGTGATTCCCGAGTGTGAAC AGGGACTTAGCCTGAGGACA AG Msc 409 mono GATCACGAACCACTGACAGGT AGTGCATCTGCATTGACGTT AG Msc 497 TGCACGCTATGAAGTACAACG TCGACTTCCAGACTCTTCCAA PCR protocol M. scalare For the hoverfly species M. scalare, PCRs were performed in a final reaction volume of 10.9 µl, containing 1 µl of DNA (ca. 10-30 ng/µl), 5.5 µl of QIAGEN Multiplex PCR Plus Kit (100), 3.3 µl of H2O, and 1.1 µl of primer mix. The primer mix for both single and multiplex PCR contained 1 μl of each forward primer (labelled with fluorescent dye; stock solution concentration 100 pmol), 0.1 μl of each reverse primer, 1 µl of oligonucleotide, and 97.9 μl of H2O per 100 µl. Table S5.2: PCR program M. scalare. Step Initial denaturation Denaturation Annealing Primer extension Den. Ann. Primer ext. Final extension Time [min] 5 0:30 1:30 0:30 0:30 1:30 0:30 30 T [°C] 94 94 57 72 94 53 72 68 30 cycles 8 cycles Table S5.3: Overview 13 polymorphic microsatellite loci for M. scalare. nA: number of alleles. Locus Motive Range [base pairs] nA Private alleles Amount missing value [%] Locus specific error rate MsC_009 AGCC 104-150 6 2 0.62 1/11 MsC_012 ACC 164-179 5 1 0 0/11 MsC_065 AG 112-120 5 1 0 0/10 MsC_073 AC 128-134 4 1 0 0/11 MsC_082 CCG 119-137 6 1 0 0/11 MsC_111 ACG 126-132 2 0 0 0/11 MsC_120 ATC 181-190 4 1 0.62 0/11 MsC_130 ACG 124-149 6 0 0 0/11 MsC_167 AAG 158-165 3 1 1.25 0/11 MsC_229 AC 150-162 7 1 0.62 0/11 MsC_290 ATC 212-237 5 1 0 0/11 MsC_324 AG 171-191 10 3 1.25 0/11 MsC_497 AG 107-111 3 0 0 0/11 Total 66 13 0.33 (mean) For Bombus pascuourm PCR protocol B. pascuorum The primers for the bumblebee species were published and tested in Estoup et al. (1995) and Estoup et al. (1996). Multiplex PCRs were performed in a final reaction volume of 15 µl, containing 0.5 µl of DNA (ca. 10-30 ng/µl), 7.5 µl of QIAGEN Multiplex PCR Plus Kit (100), 5.5 µl of H2O and 1.5 µl of primer mix. Single PCRs were performed in a final reaction volume of 10 µl, containing 0.5 µl of DNA (ca. 10-30 ng/µl), 5 µl of QIAGEN Multiplex PCR Plus Kit (100), 3.5 µl of H2O and 1 µl primer mix. For the bumblebee species B. pascuorum, we used 0.5 µL of DNA and 5.4 µL H2O, 7.5 µL Qiagen Multiplex PCR Plus Kit (100) and 0.6 µL primer per reaction. The primer mix for both single and multiplex PCR contained 1 μl of each forward primer (labelled with fluorescent dye; stock solution concentration 100 pmol), 1 μl of each reverse primer and 98 μl of H2O per 100 µl. Table S5.4: PCR program B. pascuorum. Temperatures for annealing for A): B118, B131; B): B10, B11, B96, B121, B132. Step Initial denaturation Denaturation Annealing Primer extension Final extension Time [min] 5 0:30 1:30 0:30 10:00 T [°C] 95 95 A)49 B)52 72 68 30 cycles Table S5.5: Overview eight polymorphic microsatellite loci for B. pascuorum. Primer pairs were published in Estoup et al. (1995) A and Estoup et al. (1996) B. nA: number of alleles. Locus Range [base pairs] nA Private alleles Amount missing value [%] Locus specific error rate B10 A 172-184 14 2 0.24 1/45 B11 A 126-162 12 5 0 1/45 B96 B 211-259 22 6 0 0/45 B118 B 206-250 21 0 1.44 1/45 B121 A 124-176 24 3 0.24 2/45 B124 A 225-271 15 7 1.20 0/45 B131 A 117-155 18 3 0.00 0/45 B132 B 141-164 22 0 0.00 0/45 Total 148 26 0.79 (mean) Estoup A., Scholl A., Pouvreau A., et al. (1995). Monoandry and polyandry in bumble bees (Hymenoptera; Bombinae) as evidenced by highly variable microsatellites. Molecular Ecology 4: 89-94. Estoup A., Solignac M., Cornuet J.M., et al. (1996). Genetic differentiation of continental and island populations of Bombus terrestris (Hymenoptera: Apidae) in Europe. Molecular Ecology 5: 19-31.




