TABLE 1 in First record of the microleafhopper genera Mjolnirus and Shumka from China (Cicadellidae: Typhlocybinae: Empoascini), with description of two new species

TABLE 1. The primer sequences. SpeciesPrimerSequence 5’–3’ReferenceM. shenzhenensisCOI + FGGTCAACAAATCATAAAGATATTGGFolmer et al., 1994M. shenzhenensisCOI - RTAAACTTCAGGGTGACCAAAAAATCAS. wareeaeCOI + FGGTCAACAAATCATAAAGATATTGGFolmer et al., 1994S. wareeaeCOI - RTAAACTTCAGGGTGACCAAAAAATCAS. bihamatusCOI + F1TTTTCTACWAAYCAYAAGGACATTGGAACthis studyS. bihamatusCOI - R1TATATACTTCAGGRTGCCCAAARAATCAA Note. Forward primers are indicated by ‘‘+”; reverse by ‘‘-’’.