Raw Sanger sequencing data for F0 and F1 CRISPR-Cas9 edited cane toad tyrosinase gene
收藏资源简介:
This dataset contains raw Sanger sequencing chromatogram files (.ab1 format) generated from PCR amplicons spanning CRISPR-Cas9 target sites in the tyrosinase gene of cane toads (Rhinella marina). The files include bidirectional Sanger sequencing traces from both F0 and F1 generation animals, encompassing forward and reverse sequencing reactions for each sample from completely albino and mosaic phenotype individuals, as well as control sequences from wild-type unedited animals. The sequencing data was generated to analyse CRISPR-Cas9 editing efficiency at two guide RNA target sites in exon 1 of the tyrosinase gene (GenBank accession KR012509.1). The guide RNA sequences were gRNA1: GTCTGGGCTGATGGTGCGTT and gRNA2: GCGTTGATGATCGGGAAAAC. PCR amplification targeted a 424 bp region spanning both target sites using primers Forward 5'-CCTGGAGGAGTAATAGTGAAGCC-3' and Reverse 5'-TCCTTGCGGAGAAGCTTCTG-3'. Genomic DNA was extracted from 4 dpf whole tadpoles (F0 generation) or toe clips (F1 generation) using the High Pure PCR Template Preparation Kit (Roche), followed by PCR amplification with Q5 High-Fidelity DNA Polymerase. All sequencing was performed by the Australian Genome Research Facility (AGRF), and all samples (excepte where marked with PoorQ) passed quality control with clear, readable chromatograms. The sequences from the opposite direction can be used for these samples. Files are named according to the convention [Sample_ID][gRNA1/gRNA2][Forward/Reverse].ab1. This data accompanies the publication https://doi.org/10.1101/2025.05.15.654396 and supports the molecular analysis of CRISPR-induced mutations in invasive cane toads.



