rCRUX Generated trnl plants Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.

Primer Name:  trnl plants
Gene:   trnl
Length of Target:    ~85
get_seeds_local() minimum length:    60
get_seeds_local() maximum length:    110
blast_seeds() minimum length:    23
blast_seeds() maximum length:    73
max_to_blast:  250
Forward Sequence (5'-3'):   GGGCAATCCTGAGCCAA
Reverse Sequence (5'-3'):    TTTGAGTCTCTGCACCTATC
Reference:   Coissac, E., Pompanon, F., Gielly, L., Miquel, C., Valentini, A., Vermat, T., ... & Willerslev, E. (2007). Power and limitations of the chloroplast trnL (UAA) intron for plant DNA barcoding. Nucleic Acids Research 3 (35),.(2007). https://doi.org/10.1093%2Fnar%2Fgkl938

We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.