rCRUX Generated trnl plants Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name: trnl plants Gene: trnl Length of Target: ~85 get_seeds_local() minimum length: 60 get_seeds_local() maximum length: 110 blast_seeds() minimum length: 23 blast_seeds() maximum length: 73 max_to_blast: 250 Forward Sequence (5'-3'): GGGCAATCCTGAGCCAA Reverse Sequence (5'-3'): TTTGAGTCTCTGCACCTATC Reference: Coissac, E., Pompanon, F., Gielly, L., Miquel, C., Valentini, A., Vermat, T., ... & Willerslev, E. (2007). Power and limitations of the chloroplast trnL (UAA) intron for plant DNA barcoding. Nucleic Acids Research 3 (35),.(2007). https://doi.org/10.1093%2Fnar%2Fgkl938 We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.