Primers used for HBV whole genome quasispecies amplification.

Note: Each nested primer also contained adaptor sequence tags for sequencing purpose. The forward primers were tagged with SP6 sequence (5′CGATTTAGGTGACACTATAGAAGAGAGGCT3′), and reverse primers with T7 sequence (5′CAGTAATACGACTCACTATAGGGAGAAGGC3′).*Overlapping WG primers (WG-F2 to F4) when used in the first round PCR, additional two nested primers - F7 and F8 are to be added.