rCRUX Generated MiFish Universal 12S Expanded +FishCARD Reference Database

rCRUX generated reference database using NCBI nt blast database and an additional custom blast database comprised of all Actinopterygii mitogenomes. Both blast databases were downloaded in December 2022 and supplemented with the FishCARD sequences from https://doi.org/10.5281/zenodo.4315277 . Primer Name: MiFish Universal<br> Gene: 12S<br> Length of Target: 163–185<br> get_seeds_local() minimum length: 170<br> get_seeds_local() maximum length: 250<br> blast_seeds() minimum length: 140<br> blast_seeds() maximum length: 250<br> max_to_blast: 1000<br> Forward Sequence (5'-3'): GTGTCGGTAAAACTCGTGCCAGC<br> Reverse Sequence (5'-3'): CATAGTGGGGTATCTAATCCCAGTTTG<br> Reference: Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... &amp; Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. https://doi.org/10.1098/rsos.150088 We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.