Table 1 in Gems of the southern Japanese seas - four new species of Edwardsianthus (Anthozoa, Actiniaria, Edwardsiidae) with redescriptions of two species

Table 1. Primers and protocols of polymerase chain reactions of every molecular marker.
MarkerPrimerSequences (5 ‘-3‘)PCR protocolReference12S12S1aTAAGTGCCAGCAGACGCGGT(95 °C for 4 min) + 4 × [(94°C for 30 sec) → (50°C for 1 min) → (72°C for 2 min)]+30 × [(94°C for 30 sec) → (55°C for 1 min) → (72°C for 2 min)] + (72°C for 4 min)Sinniger et al. (2005)12S3rACGGGCAATTTGTACTAACA16SANEM16SACACTGACCGTGATAATGTAGCGT(95°C for 4 min) + 30 × [(95°C for 30 sec) → (46°C for 45 sec) → (72°C for 1 min)] + (72°C for 5 min)Geller and Walton (2001)ANEM16SBCCCCATGGTAGCTTTTATTCG16Sant1aGCCATGAGTATAGACGCACA(95°C for 4 min) + 30 × [(95°C for 30 sec) → (46°C for 45 sec) → (72°C for 1 min)] + (72°C for 5 min)Sinniger et al. (2005)16SbmoHCGAACAGCCAACCCTTGG18SPCR18SAAACCTGGTTGATCCTGCCAGT(94°C for 4 min) + 35 × [(94°C for 20 sec) → (57°C for 20 sec) → (72°C for 1 min 45 sec)] + (72°C for 7 min)Medlin et al. (1988) Apakupakul et al. (1999)18SBTGATCCTTCCGCAGGTTCACCTOnly sequence18SLCCAACTACGAGCTTTTTAACTG18SCCGGTAATTCCAGCTCCAATAG18SYCAGACAAATCGCTCCACCAAC18SOAAGGGCACCACCAGGAGTGGAG