Signatures of hybridization in Trypanosoma brucei

Genetic exchange among disease-causing micro-organisms can generate progeny that combine different pathogenic traits. Though sexual reproduction has been described in trypanosomes, its impact on the epidemiology of Human African Trypanosomiasis (HAT) remains controversial. However, human infective and non-human infective strains of Trypanosoma brucei circulate in the same transmission cycles in HAT endemic areas in sub-Saharan Africa, providing the opportunity for mating during the developmental cycle in the tsetse fly vector. Here we investigated inheritance among progeny from a laboratory cross of T. brucei and then applied these insights to genomic analysis of field-collected isolates to identify signatures of past genetic exchange. Genomes of two parental and four hybrid progeny clones with a range of DNA contents were assembled and analysed by k-mer and single nucleotide polymorphism (SNP) frequencies to determine heterozygosity and chromosomal inheritance. Variant surface glycopro..., , , , # Signatures of hybridization in *Trypanosoma brucei* Dataset DOI: [10.5061/dryad.xd2547djb](10.5061/dryad.xd2547djb) ## Description of the data and file structure Read data for the hybrid clones from the experimental cross is available from the NCBI SRA (Sequence Read Archive [https://www.ncbi.nlm.nih.gov/sra](https://www.ncbi.nlm.nih.gov/sra) Project no. PRJNA795331 All other data have been deposited here. The project contains the folders listed below. Each folder contains a “Readme” file with further details of the contents. ### assembled\_genomes The genomic SPAdes assembled genomes used to predict ORFs and subsequently VSGs, contigs are of the form: \>NODE_166886_length_56_cov_1939465.000000 GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGG ### introgression\_maps Contains the VCF files used to construct the introgression maps, the script to derive them, and breakdowns of SNP types/density. ### Hybrid\_and\_parent\_maxicircle\_whole\_coding\_region FASTA file con...