Table A 2 in Leaving no stone unturned: three additional new species of Atractus ground snakes (Serpentes, Colubridae) from Ecuador discovered using a biogeographical approach

Table A2. List of PCR and sequencing primers and their respective PCR conditions (denaturation, annealing, extension, and number of corresponding cycles) used in this study. All PCR protocols included an initial 3-min step at 94 °C and a final extension of 10 min at 72 °C. LocusPrimerSequence (5 ’-3’)ReferencePCR profile16S16Sar-LCGCCTGTTTATCAAAAACATPalumbi et al. (1991)30 cycles of 94 °C (45 sec), 53 °C (45 sec), 72 °C (1 min)16Sbr-H-RCCGGTCTGAACTCAGATCACGTCytbL14910GACCTGTGATMTGAAAACCAYCGTTGTBurbrink et al. (2000)94 °C (1 min), 58 °C (1 min), 72 °C (2 min) [x30-36]H16064CTTTGGTTTACAAGAACAATGCTTTAND4ND4CACCTATGACTACCAAAAGCTCATGTAGAAGCArévalo et al. (1994)94 °C (25 sec), 56 or 60 °C (1 min), 72 °C (2 min) [x25-30]LeuCATTACTTTTACTTGGATTTGCACCAS78CCTTGGGTGTGATTTTCTCACCT