rCRUX Generated 18s SSU3/SSU4 Metazoan Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.

Primer Name:  18s SSU3/SSU4 Metazoan
Gene:   18S v7
Length of Target:    170
get_seeds_local() minimum length:    120
get_seeds_local() maximum length:    220
blast_seeds() minimum length:    98
blast_seeds() maximum length:    200
max_to_blast:  100
Forward Sequence (5'-3'):   GGTCTGTGATGCCCTTAGATG
Reverse Sequence (5'-3'):    GGTGTGTACAAAGGGCAGGG
Reference:   McInnes, J. C., Alderman, R., Deagle, B. E., Lea, M. A., Raymond, B., & Jarman, S. N. (2017). Optimised scat collection protocols for dietary DNA metabarcoding in vertebrates. Methods in Ecology and Evolution, 8(2), 192-202. http://dx.doi.org/10.1111/2041-210X.12677

We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.