rCRUX Generated 18s SSU3/SSU4 Metazoan Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name: 18s SSU3/SSU4 Metazoan Gene: 18S v7 Length of Target: 170 get_seeds_local() minimum length: 120 get_seeds_local() maximum length: 220 blast_seeds() minimum length: 98 blast_seeds() maximum length: 200 max_to_blast: 100 Forward Sequence (5'-3'): GGTCTGTGATGCCCTTAGATG Reverse Sequence (5'-3'): GGTGTGTACAAAGGGCAGGG Reference: McInnes, J. C., Alderman, R., Deagle, B. E., Lea, M. A., Raymond, B., & Jarman, S. N. (2017). Optimised scat collection protocols for dietary DNA metabarcoding in vertebrates. Methods in Ecology and Evolution, 8(2), 192-202. http://dx.doi.org/10.1111/2041-210X.12677 We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.