Prognostic, biological, and structural implications of FLT3-JMD point mutations in acute myeloid leukemia: an analysis of Alliance studies

A FLT3 gene frequently undergoes mutations in acute myeloid leukemia (AML), with internal tandem duplications (ITD) and tyrosine kinase domain (TKD) point mutations (PMs) being most common. Recently, PMs and deletions in the FLT3 juxtamembrane domain (JMD) have been identified, but their biological and clinical significance remains poorly understood. We analyzed 1660 patients with de novo AML and found FLT3-JMD mutations, mostly PMs, in 2% of the patients. Patients with FLT3-JMD mutations had a higher relapse rate and shorter disease-free survival than those with FLT3-TKD, whereas their relapse rate, disease-free and overall survival were not significantly different from those of FLT3-ITD-positive patients. In vitro experiments showed that FLT3-JMD PMs transformed hematopoietic cells and responded well to type I and II FLT3 inhibitors. Molecular dynamics simulations were used to explore the conformational changes of JMD PMs relative to wild-type FLT3. These mutations exhibited constrained domain motions with wider gate openings, potentially enhancing drug binding. Altered residue interactions and structural changes shed light on their unique functional mechanisms, with increased allosteric pathways suggesting reduced interactions with other residues. We conclude that patients with FLT3-JMD PMs represent uncommon but important subset with distinct molecular and biological features, and may benefit from FLT3 inhibitors.

Methods
Viably frozen tumor samples were thawed and stained with Live Dead green stain (Thermo Fisher Scientific L23105) and CD45-Amcyan (clone 2D1). Single live BLASTS were sorted into the wells of a PCR plate containing 3uL of DirectPCR Lysis-Reagent for cells (peQlab 31-301-C) with 0.2mg/mL Proteinase K (Qiagen). To amplify FLT3 exons 13-15 PCR was performed with outer primers, left: (CCTGATTGTCTGTGGGGAGT) right:(GTTGACACCCCAATCCACTC), using Q5 High-Fidelity 2X Mater Mix (NEB) in the same plate as cell lysis. Nested PCR was performed using 2uL of PCR product from the outer PCR as template, primers left:(AGGAATTCTGTTTCATCGCTGA) right:(TCTTTGTTGCTGTCCTTCCAC) and the same PCR master mix as above. Product size of 594bp was confirmed by 1% agarose gel. ExoSAP-IT PCR Product Cleanup Reagent (Thermo Fisher Scientific) was used according to the manufacturer’s instructions. Clean PCR product was Sanger sequenced in the OSUCCC Genomics Shared Resource on an Applied Biosystems 3730xl using both the left and the right the nested primers. Sequences were aligned to reference (NCBI: NG_007066.1) using Sequencher 5.4.6 (Gene Codes Corporation).