Evaluation and optimization of sequence-based gene regulatory deep learning models

As training dataset for Random Promoter DREAM Challenge 2022, we generated ~6.7 million synthetic promoters (in yeast) comprised of random DNA (N80) and measured their expression by FACS (sorting into 18 bins). As test dataset for Random Promoter DREAM Challenge 2022, we generated ~71k synthetic promoters (in yeast) comprised of designed DNA (NBT) and measured their expression by FACS (sorting into 18 bins). Two promoter libraries (random N80 and designed NBT), embedded within a promoter scaffold with a distal poly-T and proximal poly-A tract (pTpA) regulating yellow flourescent protein (YFP) was tested in Chardonnay (Chard). The sequences flanking the random 80 bp oligo were as follows: the pTpA distal region was (pT) GCTAGCAGGAATGATGCAAAAGGTTCCCGATTCGAACTGCATTTTTTTCACATC and proximal region (pA) was GGTTACGGCTGTTTCTTAATTAAAAAAAGATAGAAAACATTAGGAGTGTAACACAAGACTTTCGGATCCTGAGCAGGCAAGATAAACGA (up to the theoretical TSS). In both cases, 80 Ns were inserted in between proximal and distal regions.