Transcriptomics analysis of gene expression in wildtype and foxo1 synonymous mutated mouse liver
收藏资源简介:
The selected gRNA sequence is tggcatgtttattgagcgctTGG. To disrupt the demethylation motif RRACT in 2288-2290 of Foxo1 mRNA (NM_019739), a mutation (ttGGACT to ctCGATT) target vector was constructed with 1214bp 5'arm and 849bp 3'arm. Mouse zygotes obtained by mating of males with superovulated C57BL/6J females, were injected with a mixture of Cas9 mRNA (80 ng/ul), sgRNA (40 ng/ul) and Donor vector (8 ng/ul). Microinjections were performed into the male pronucleus of fertilized oocytes. Injected zygotes were transferred into pseudopregnant CD1 female mice, and viable adult mice were obtained. Mice were genotyped using sequencing and PCR. PCR primers: mut-F1, ATCCCCATTGAGCAGTAAGTTTTCCA; mut-R1, TGATGGACTCCATGTCACAATCGAG; mut-F2, GCATGTTTATTGAGCGCCTCGAT; mut-R2, CCGCTGTTGCCAAGTCTGAGG; wt-R1, TGATGGACTCCATGTCACAGTCCAA. PCR genotyping of wild-type (wt) and mutant (mut) mice was using primers mut-F1 and mut-R1 to generate fragments of 1291 bp for mut allele, using primers mut-F2 and mut-R2 to generate fragments of 930 bp for mut allele, and using primers mut-F1 and wt-R1 to generate fragments of 1291 bp for wt allele. Total RNA was isolated from Liver Tissue using the TRIzol (Invitrogen) reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq RNA Sample Prep Kit v2 (Illumina, San Diego, CA, USA) according to the manufacturer's protocol.The libraries were sequenced using HiSeq3000 (Illumina) in paired-read mode, creating reads with a length of 101 bp. Sequencing chemistry v2 (Illumina) was used. Examination of gene expressive levels in wildtype and foxo1 synonymous mutated mouse liver



