Halomonas bluephagenesis Raw sequence reads

To analyze the mutagenesis characteristics of the orthogonal transcription mutators, three dual-type mutators (pMT23d-MmP1, pMT32d-MmP1, and pMT23opt-MmP1), as well as the control pMT0-MmP1, were transferred into H. bluephagenesis strains with the sacB gene within the genome. Next, these strains were incubated in 60LB medium with 200 mg/L IPTG for 20 h for the mutation induction assay, as described above. Subsequently, to obtain DNA fragments containing the sacB gene, the culture solution was subjected to PCR using the primers CTGTTTGATGGTGGTTAACGGC and CAGCGCCAGTAGTACTCCTATCA. A total of a 3585 bp DNA fragment was amplified, containing a target region of 2024 bp, an upstream region of 961 bp and a downstream region of 600 bp. The amplicon library construction, Illumina paired-end sequencing (PE150), and data preprocessing were performed by GENEWIZ, Inc. (Suzhou, China).