File S1 - Alternative Functions of Arabidopsis YELLOW STRIPE-LIKE3: From Metal Translocation to Pathogen Defense

Contains: Figure S1. Time-course expression of selected SA-induced genes (SAIG). RT-PCR analysis of selected SAIG gene expression in wild-type plants. Total RNA from 2-week-old seedlings treated with 0.5 mM SA (SA) or maintained in MS medium (C) for the times (hours) indicated were isolated for RT-PCR. LLP (At5g03350) and PR1 (At2g14610) were used as controls for NPR1-dependent early and late response genes, respectively. ACT3 (At3g53750) was a control. The following primers were used for RT-PCR: YSL3-FP: 5′-ATGAGGAGTATGATGATGGAGAGAGAG -3′ YSL3-RP: 5′-TTAACTCGAATATTTACTCGGCATGAAGC -3′; LLP-FP: 5′-TTGGGAAAATGAAACACTGGTC-3′ LLP-RP: 5′-CATTCCGGTTACAACTTTCTGATAC-3′; PR1-FP, 5′-TTCTTCCCTCGAAAGCTCAA-3′; PR1-RP, 5′-TTGCAACTGATTATGGTTCCAC-3′); ACT3-FP: 5′-GCTATGTATGTCGCCATTCAAGC-3′ ACT3-RP: 5′-CATCATATTCTGCCTTTGCGATCC-3′ Cycles for amplification of each gene are indicated. Figure S2. Two T-DNA SALK lines, SALK_064683 (ysl3-1) and SALK_045218 (ysl3-2), of YSL3. A, Relative positions of T-DNA insertions in YSL3. White boxes and lines represent exons and introns, respectively. Insertion sites of T-DNA and orientation are illustrated by triangles with arrowheads. Primers used for RT-PCR are indicated. B, Genotyping of ysl3-1 and ysl3-2 mutants. Primers used for genotyping are ysl3-1 LP: CCCTCGATATTTTGCTTAGGG; ysl3-1 RP: CTTCACCTAGGTCGATGCTTG; ysl3-2 LP: GCCTTTAGGAGTGTGGAAACC ysl3-2 RP: TTTTTCCTCTCGTCATTTTCC and LBb1.3: ATTTTGCCGATTTCGGAAC. PCR reactions in 1 involved primers LP and RP and in 2 LBb1.3 and RP. C, RT-PCR to detect the expression of YSL3. The following primers were used for RT-PCR: YSL3 FP: ATGAGGAGTATGATGATGGAGAGAGAG; YSL3 RP: TTAACTCGAATATTTACTCGGCATGAAGC; ACT8 FP: CCACATGCTATCCTCCGTCT and ACT8 RP: CTGGAAAGTGCTGAGGGAAG. ACT8 (At1g49240) expression was a control. Figure S3. Two T-DNA insertion lines of ysl3 mutants with enhanced susceptibility to P. syringae pv. tomato DC3000 infection. A, Disease symptoms on leaves of each Arabidopsis line after inoculation with Pseudomonas syringae pv. tomato (Pst) DC3000. Four-week-old Arabidopsis thaliana Col-0 wild type (WT), ysl3-1, ysl3-2 and npr1 grown in the soil were spray-inoculated with 107 cfu/mL Pseudomonas syringae pv. tomato (Pst) DC3000 in 10 mM MgCl2 with 0.02% Silwet L-77. Photographs were taken 3 days post-inoculation (dpi). Bar scale is 1 cm. B, Bacterial population in leaves of each Arabidopsis line after inoculation of Pst DC3000. 0 and 3 dpi, leaf samples were collected and bacterial number was determined. Data are mean±SD from 4 replicates. Different letters indicate significant difference at pFigure S4. Time course of YSL3 gene expression in Arabidopsis. YSL3 expression in Pst DC3000-infected and mock-inoculated (Mock) Arabidopsis (Col-0) plants at 0, 1, 3, 6, 12, 24, 48 and 72 h post-inoculation (hpi) monitored by qPCR. Total RNA from 3-week-old seedlings grown at 22°C on soil were used as templates. qPCR analysis of YSL3 expression relative to that of ACT2. Data are mean±SD from 6 samples of 2 biological repeats. Figure S5. RT-PCR analysis of YSL3 expression in the wild type, sid2 and npr1. RT-PCR analysis of YSL3 and PR1 expression in Pst DC3000-infected and mock-inoculated (Mock) Arabidopsis Col-0 wild-type (WT), sid2-1 and npr1 plants over 2 days post-inoculation (dpi). Total RNA from 3-week-old seedlings grown at 22°C on soil was used as templates. ACT3 was a control. Cycles for amplification of each gene are indicated. (PDF)