Identification of differentially-expressed genes between FoxH1 morpholino and control in zebrafish embryos.

The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene. 34k expression arrays were generated by printing Oligo nucleotides from three different sets (MWG, Compugen and Operon) onto epoxy slides. Total RNA from 50 FoxH1 MO- and 50 control MO-injected embryos was amplified using an Ambion kit (Cat#1753), labeled with Cy dyes and hybridized overnight to the oligo chip. This procedure was performed three times independently, including one dye swap, and cRNA from FoxH1 morphants and control embryos were co-hybridized for a total of three hybridizations.