Southern Ocean eDNA metabarcoding raw sequencing data, collected on the Aurora Australis 2019-2020
收藏Research Data Australia2024-12-14 收录
下载链接:
https://researchdata.edu.au/southern-ocean-edna-2019-2020/2821815
下载链接
链接失效反馈官方服务:
资源简介:
On the return leg of the V1 2019 resupply voyage from Davis station to Hobart on the RSV Aurora Australis paired, open ocean environmental DNA (eDNA) samples were taken at 29 locations along the voyage. Sample names, sample coordinates as well as a range of environmental variables at each location are listed in file ‘V1 2019 Samples.xlsx’. Each sample pair consisted of one 2 L sample filtered through a 0.45 μm pore size filter, and one 12 L sample filtered through a 20 μm pore size filter. Filtering happened on board immediately after sampling. Filters of the 2 L samples were halved and stored in separate tubes, then immediately frozen at -80 ˚C. Filters of the 12 L samples were stored whole and also frozen at -80 ˚C. DNA of all samples was extracted at the specialised lab ‘eDNA frontiers’ located at Curtin University, WA using DNeasy Blood and Tissue Kits, and the extracted DNA sent back to the genetics lab at the Australian Antarctic Division (AAD). Several metabarcoding approaches were conducted to survey metazoan biodiversity present in these samples:
- A marker targeting the mitochondrial gene cytochrome c oxidase I (COI) using metazoan specific primers (Forward primer mlCOIintF: GGWACWGGWTGAACWGTWTAYCCYCC; reverse primer jgHCO2198). This marker was used twice, using identical PCR conditions (95 °C for 10 min, a 16 cycle touchdown phase (62 °C -1 °C per cycle), followed by 25 cycles with an annealing temperature of 46 °C (total of 41 cycles), and a final extension at 72 °C for 5 min). : once using a two PCR step method, using MID tagged primers in the first round of PCR, and MID tagged Illumina sequencing adapters in the second round of PCR (second round PCR conditions using MID tagged Illumina sequencing adapters with this and all other markers listed below were: 95 °C for 10 min, 10 cycles of 95 °C for 30 sec, 55 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘COI dual tagged’. The second method used a one round PCR with fusion tagged primers, conducted at Curtin University and sequenced there as well. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘COI fusion tagged’.
- A marker targeting the mitochondrial 16S rRNA gene, using fish specific primers (Forward primer Fish_F: GACGAGAAGACCCYRTGRAG; reverse primer Fish_R GACGAGAAGACCCYRTGRAG) with the following PCR conditions: 95 °C for 10 min, 45 cycles of 95 °C for 30 sec, 60 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min. PCR were conducted in two steps as described above (first round PCR with MID tagged markers, second round PCR with MID tagged Illumina sequencing adapters). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Fish’.
- A marker targeting the mitochondrial 16S rRNA gene, using mammal specific primers (Forward primer Mammal_F: CAATTTNGGTTGGGGTGA; reverse primer Mammal_R GGATTGCGCTGTTATCCCTA) with the following PCR conditions: 95 °C for 10 min, 45 cycles of 95 °C for 30 sec, 56 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min. PCR were conducted in two steps as described above (first round PCR with MID tagged markers, second round PCR with MID tagged Illumina sequencing adapters). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Mammal’.
- A marker targeting the mitochondrial 16S rRNA gene, using krill specific primers (Forward primer Crust_F: GTGACGATAAGACCCTATA; reverse primer Crust_R ATTACGCTGTTATCCCTAAAG) with the following PCR conditions: 95 °C for 10 min, 45 cycles of 95 °C for 30 sec, 56 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min. PCR were conducted in two steps as described above (first round PCR with MID tagged markers, second round PCR with MID tagged Illumina sequencing adapters). Sequencing was done on an Illumina MiSeq sequencing machine located at the Menzies Institute in Hobart, Tasmania. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Krill’.
Using the fish and mammal specific metabarcoding markers, we detected the presence of several fish and marine mammal species in a subset of eDNA samples. These markers were tested again with a number of additional markers:
- A marker targeting the mitochondrial control region, using whale specific primers (Forward primer Dloop_1.5_F: CCACAGTACTATGTCCGTATT; Reverse primer Dlp4_R: GCGGGWTRYTGRTTTCACG) with the following first round PCR conditions: 95 °C for 10 min, 40 cycles of 95 °C for 30 sec, 54 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min. First round markers were untagged. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Whale DLoop 1.5’.
- A marker targeting the mitochondrial control region, using whale specific primers (Forward primer Dloop_10_F: TCACCCAAAGCTGRARTTCTA; Reverse primer Dlp4_R: GCGGGWTRYTGRTTTCACG) with the following first round PCR conditions: 95 °C for 10 min, 40 cycles of 95 °C for 30 sec, 54 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min. First round markers were untagged. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Whale DLoop 10’.
- A marker targeting the mitochondrial control region, using a nested PCR approach with whale specific primers (First round forward primer Dloop_1.5_F: CCACAGTACTATGTCCGTATT; Reverse primer Dloop_5_R: CCATCGWGATGTCTTATTTAAGRGGAA. Second round forward primer Dloop_1.5_F: CCACAGTACTATGTCCGTATT, reverse primer Dlp4_R: GCGGGWTRYTGRTTTCACG) with the following first round PCR conditions: 95 °C for 10 min, 40 cycles of 95 °C for 30 sec, 54 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min, and identical second round PCR conditions with the exception of only 20 cycles of amplification. First round markers as well as Illumina adaptors were MID tagged. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Whale DLoop Nested’.
- A marker targeting the mitochondrial 16S rRNA gene using vertebra specific, MID tagged primers (Forward primer MarVer3_F: AGACGAGAAGACCCYRTG; reverse primer MarVer3_R: GGATTGCGCTGTTATCCC) with the following first round PCR conditions: 95 °C for 10 min, 40 cycles of 95 °C for 30 sec, 54 °C for 30 sec and 72 °C for 45 sec, and a final extension at 72 °C for 5 min. Raw sequencing files as well as details of PCR reactions and MID tags for each sample are in folder ‘Vertebra’.
提供机构:
Australian Ocean Data Network



